High-Throughput Screening of Interaction Partners for MAGE-H1 during Retinoic Acid-Induced Neural Differentiation of P19 Cells Using SILAC-Immunoprecipitation Quantitative Proteomics Approach

High-Throughput Screening of Interaction Partners for MAGE-H1 during Retinoic Acid-Induced Neural Differentiation of P19 Cells Using SILAC-Immunoprecipitation Quantitative Proteomics Approach

Corresponding author: Dr. Yong Liu and Shaojun Liu, State Key Laboratory of Proteomics, Department of Neurobiology, Institute of Basic Medical Sciences, Beijing 100850, China, Tel: 86-10-66931304; Fax: 86-10-68213039;

E-mail: liuyongxiao1225@hotmail.com ; liusj@bmi.ac.cn Received: 11-15-2016

Abstract

MAGE-H1 might be involved in the early process of neurogenesis. However, fundamental roles of MAGE-H1 during neurogen- esis still need to be further investigated. In this study, we used Stable Isotope Labeling by Amino acids in Cell culture (SILAC)

-immunoprecipitation quantitative proteomics to identify interaction partners of MAGE-H1 during retinoic acid (RA)-induced neural differentiation of P19 cells, and found that 62 proteins could specifically interact with MAGE-H1. Subsequently, we per- formed functional annotation of the identified proteins. The 62 proteins were assigned to 10 functional categories according to biological processes, and 12 functional categories according to pathways. Finally, we confirmed endogenous complex for- mation between MAGE-H1 and the identified proteins, such as Glutathione S-transferase P 1(GSTP1), myosin-Ib (MYO1B) or Inosine-5’-monophosphate dehydrogenase 2(IMDH2), in P19 cells treated with RA for 6 days. Those results may provide clues to further elucidate the functions of MAGE-H1 during neural differentiation.

Keywords: Quantitative proteomics; SILAC; Protein interaction; MAGE-H1; Neural differentiation

Introduction

The melanoma antigen (MAGE) family comprises 30 genes in mouse[1]. The MAGE family of proteins is dividedinto two class- es (type I and type II) based on their expression pattern. Type I MAGE is completely silenced in normal tissues except male germ cells and placenta, whereas type II MAGE is expressed in both tumors and a fraction of normal tissues[2]. The type II MAGE proteins may be divided further into two subgroups. Necdin subgroup includes Necdin, MAGE-F1, MAGE-G1/Nec- din-like 2, and MAGE-H1, and MAGE-D subgroup includes MAGE-D1/NRAGE/Dlxin-1, MAGE-D2, MAGE-D3/Trophinin/ Magphinin, MAGE-E1/MAGE-D4, and MAGE-L2 [2, 3].

MAGE-H1 belongs to the type II MAGE family and is known as Restin [4]. MAGE-H1 was firstly cloned from the differentiated HL-60 cells induced by all-trans retinoic acid (RA) [5], an apoptosis and differentiation inducer. MAGE-H1 was identified as one of pro-apoptotic genes that determined the response of multiple tumor cells to CD95-mediated apoptosis [6]. It was disclosed that MAGE-H1 overexpression induced apoptosis of melanoma cells via interacting with p75 neurotrophin recep- tor (p75NTR), leading to the disruption of both NF- kB and extra- cellular signal-regulated kinase pathways [4]. Thus, MAGE-H1 may function as a tumor suppressor, which is similar to Necdin and Mage-D1. Nevertheless, little information is available on its functions, particularly its roles in neurogenesis.

An essential step in understanding protein function is identi- fication of relevant interacting proteins. There are a number of techniques available, which include the yeast two-hybrid system, pull-down assays using recombinant protein, as well

as tandem affinity purification or TAP-tagging[7, 8]. Howev- er, these techniques suffer from high false positive and false negative rates, because the assay is usually performed under non-physiological conditions and the posttranslational dynam- ics are not taken into account. Recent Stable Isotope Labeling by Amino acids in Cell culture (SILAC) -immunoprecipitation quantitative proteomics are providing us with the tools to tack- le many of the obstacles mentioned above[9]. In this method, cells containing an affinity tagged protein are grown in heavy isotopic medium while wild-type cells are grown in light isoto- pic medium. After mixing equal quantities of these two popula- tions of cells, an immunoprecipitation is performed against the affinity tag. In mass spectrum (MS), specific partners appear as isotopically heavy, while non-specific interaction partners appear as a mixture of isotopically light and heavy at a 1:1 ra- tio. This has advantages over the yeast two-hybrid approach in that cell localization and post-translational modifications are not perturbed, as well as advantages over traditional TAP-tag- ging in that it is a quantitative rather than qualitative approach allowing the user to readily distinguish non-specifically inter- acting proteins and contaminants[10, 11].

In this study, we used SILAC-immunoprecipitation quantita- tive proteomics to identify interacting partners of MAGE-H1 during RA-induced neural differentiation of P19 cells. These studies facilitated a better understanding of the fundamental aspects of MAGE-H1 during neurogenesis.

Materials and Methods

Plasmid Construction

The mouse MAGE-H1 cDNA was amplified using primers (5’- AAAAAGGATCC ATGCCTCGGGGACGGAA -3’ and 5’- AAAGAAT- TC CTATGGAGCAGAATAACCCCTAGC -3’) by RT-PCR from

mouse embryonic carcinoma P19 cells, and then subcloned into the BamH I and EcoR I sites of pCMV-tag 2B vector (Agi- lent Technologies, USA), which is modified to contain an N-ter- minal Flag tag.

P19 Cell Culture and Stable Transfection

P19 cells were obtained from the American Type Culture Col- lection (ATCC, CRL 1825) and cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen, USA) supplemented with 10% fetal bovine serum (Invitrogen, USA), 2 mM L-gluta- mine, 1% penicillin/streptomycin (Sigma-Aldrich,USA) under 5% CO2 atmosphere at 37 °C. The pCMV-tag-2B-MAGE-H1 and empty vector pCMV-tag-2B plasmids were transfected respec- tively into the P19 cells by Lipofectamine 2000 (Invitrogen,U- SA). At 48 hours after transfection, the media was replaced with G418-containing media (800µg/ml). Individual colonies were picked following 2 weeks of selection. Transfection efficiency was confirmed by measuring the expression of MAGE-H1 with Western blotting assay. After initial selection, stably transfected cells were maintained in the media with 200µg/ml G418.

Stable Isotope Labeling

The P19 cells stably transfected pCMV-tag-2B-MAGE-H1 plas- mid were grown in SILAC DMEM “heavy” media (Thermo, USA) without lysine and arginine, supplemented with 10% dialyzed fetal calf serum (Thermo, USA) , 1% penicillin/strep- tomycin (Sigma-Aldrich,USA), 100μg/ml L-arginine-HCl and 100μg/ml 13C6-L-lysine-2HCl (both from Thermo, USA). The P19 cells stably transfected empty vector pCMV-tag-2B plas- mid were grown in SILAC DMEM “light” media (Thermo, USA) without lysine and arginine, supplemented with 10% dialyzed fetal calf serum, 1% penicillin/streptomycin, 100μg/ml L-ar- ginine-HCl and 100μg/ml 12C6-L-lysine-2HCl (Thermo, USA)

. Passage both cell populations for at least five cell doublings by changing medium every 2-3 days. After five cell doublings, harvest cells from each sample (light and heavy) to determine incorporation efficiency. Once full isotope incorporation has been determined, continue to expand light- and heavy-labeled cells to desired cell number required for subsequent cell lysis.

P19 Cell Differentiation

To induce neural differentiation, the stably transfected P19 cells were allowed to aggregate in bacteriological-grade Petri dishes at a seeding density of 1×105 cells/ml in the presence of 1 μM all-trans-retinoic acid (Sigma-Aldrich,USA) in minimum essential medium (Wako, Japan) supplemented with 10% fetal bovine serum (Sigma-Aldrich,USA)[12] . After being aggregat- ed for 4 days, cells were dissociated into single cells by 0.05% trypsin-0.53 mM EDTA and were replated in a poly-L-lysine coated tissue-culture dish at a density of 3×105 cells/ml in an N2 serum-free medium (DMEM/F12 supplemented with 5 mg/mL insulin, 50 mg/ml human transferrin, 20 nM proges- terone, 60 mM putresine, and 30 nM sodium selenite). The cells were then allowed to adhere and culture for at most 6 days with replacement of the medium every 2 days.

Immunoprecipitation

The two group cells (light and heavy) were harvested and lysed respectively in IP Lysis Buffer (Thermo, USA) (25 mM Tris•H- Cl pH 7.4, 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycer-

ol) supplemented with protease and phosphatase inhibitors (Roche, Switzerland). After determine protein concentration of each sample in triplicate using BCA Protein Assay Kit (Ther- mo, USA), equal protein amounts of each cell lysate were mix. The equally mixed sample (2mg) were incubated with 10 µg rabbit anti-Flag polyclonal antibody (MBL,USA) in 1ml IP Lysis Buffer for 8 hours at 4°C, and the immune complexes were pre- cipitated with 20 µl Protein A/G Plus-agarose (Santa Cruz Bio- technology,USA). The immunoprecipitates were then separat- ed by 12% SDS–polyacrylamide gel electrophoresis. After the gel was stained with Coomassie Brilliant Blue G-250, each lane

was cut into 10 gel slices (0.5cm × 0.5cm) for LTQ-MS analysis.

Liquid Chromatography Tandem Mass Spectrometry

Each slice of the Coomassie G-250-stained gel was in-gel di- gested using 0.1µg of trypsin in 25µl of 50mM ammonium bi- carbonate, pH 7.8. The samples were loaded on a C18 trap col- umn (C18 PepMap, 300 μm ID × 5 mm, 5 μm particle size,300 Å pore size; Dionex, Amsterdam, The Netherlands) and eluted onto a SCX capillary column (100 mm × 320 μm id). The am- monia acetate concentration of elution steps for SCX capillary column were 0 mM, 25 mM, 75 mM, 100 mM and 1M. The elut- ed peptides were then transferred onto a RP capillary column (PepMap C18, 75 μm ID ×150 mm, 3 μm particle and 100 Å pore size; Dionex, Amsterdam, The Netherlands). The elution gradient for RP column was from 5% to 30% buffer B (0.1% formic acid, 99.9% acetonitrile) over 3 hours at a flow rate of 2 μl/min. MS data were acquired in a survey scan from 400-2000 amu (1 μscans) followed by ten data-dependent MS/MS scans (10 μscans each, isolation width 3 amu, 35% normalized colli- sion energy, dynamic exclusion for 1.5 minutes) on an LTQ XL electrospray ion trap mass spectrometer (Thermo, USA).

Database Searching

Tandem mass spectra were extracted, charge state deconvolut- ed and deisotoped by Mascot Distiller version 2.4.3.3. All MS/ MS samples were analyzed using Mascot (Matrix Science, Lon- don, UK; version 2.4.1). Mascot was set up to search the Swis- sProt_2013_01 database (selected for Mus., 2013.01, 16638 entries) assuming the digestion enzyme trypsin. Mascot was searched with a fragment ion mass tolerance of 0.80 Da and a parent ion tolerance of 5.0 PPM. Carbamidomethyl of cysteine was specified in Mascot as a fixed modification. Glu->pyro-Glu of the n-terminus, ammonia-loss of the n-terminus, gln->pyro- Glu of the n-terminus, amidated of the c-terminus, label:13C(6) of lysine, oxidation of methionine and acetyl of the n-terminus were specified in Mascot as variable modifications.

Criteria for Protein Identification

Scaffold (version Scaffold_4.0.5, Proteome Software Inc., Port- land, OR) was used to validate MS/MS based peptide and protein identifications. Peptide identifications were accepted if they could be established at greater than 95.0% probabili- ty by the Peptide Prophet algorithm with Scaffold delta-mass correction[13]. Protein identifications were accepted if they could be established at greater than 80.0% probability and contained at least 1 identified peptide. Protein probabilities were assigned by the Protein Prophet algorithm[14]. Proteins that contained similar peptides and could not be differentiat- ed based on MS/MS analysis alone were grouped to satisfy the principles of parsimony.

Gene Ontology Enrichment Analysis

Gene Ontology (GO) enrichment analysis allows one to identi- fy characteristic biological attributes in a given gene set. It is based on the hypothesis that functionally related genes should accumulate in the corresponding GO category. To understand the key biological processes and pathways in which MAGE-H1 interactors were involved, GO enrichment analyses were per- formed (http://geneontology.org/). The genes of MAGE-H1 interactors were subjected to GO enrichment analysis. The ontological relevance of those genes was ascertained by using overrepresented GO terms (biological process and pathways) obtained from the enrichment analysis.

Immunoblot Analysis

The immunoprecipitated or cells extract proteins were sep- arated by 12% SDS–polyacrylamide gel electrophoresis and blotted onto nitrocellulose membrane (Osmonics,USA) using a semidry blotting apparatus (Bio-Rad,USA). The membranes were first blocked with 5% skimmed milk in washing buffer (20 mM Tris, 150 mM NaCl, 0.05% Tween-20, pH 7.6) over- night at 4°C and incubated with primary antibodies, and then with appropriate horseradish peroxidase-labeled secondary antibodies (Santa Cruz Biotechnology,USA) after few washes. The blots were visualized using an enhanced chemilumines- cence immunoblotting detection kit (Vigorous, China).

 

Discussion

Using model of RA-induced neural differentiation of P19 cells, our previous study found that MAGE-H1 mRNA had 4-fold in- crease at day 6 of differentiation compared with the RA-un- treated P19 cells[15]. It was suggested that MAGE- H1 might be involved in the early process of neurogenesis. Previous research indicated that it could interact with p75NTR at the in- tracellular domain and be considered as a cell cycle control protein[16]. However, fundamental roles of MAGE-H1 during neurogenesis still need to be further investigated.

In this study, we generated a P19 cell line that stably expressed the Flag-tagged mouse MAGE-H1, and we dissected the P19 cells-specific MAGE-H1 interactome formed during RA-in- duced neural differentiation, using an SILAC based quantita- tive proteomic approach. Briefly (Figure 1A), the Flag-MAGE- H1-expressing P19 cells were grown in the ‘‘heavy’’ medium containing 13C6 L—lysine, whereas the control cells (vector only) were maintained in ‘‘light’’ medium containing 12C6 L— lysine. After P19 cells were treated with RA to induce neural differentiation for 6 days, the proteins extracted from each group were mixed in a ratio of 1:1 based on the total protein mass, and anti-Flag beads were added to immunoprecipitate the MAGE-H1 interacting complex for the following SDS-PAGE separation (Figure 1B), in-gel trypsin digestion, and LC–MS/ MS analysis. Before in-gel trypsin digestion, western blotting

assay was used to confirm that Flag-MAGE-H1 was able to be immunoprecipitated from premixed or mixed (1:1) cell lysates (Figure 1C).

Marker IP

FLAG-MAGE-H1

Figure 1A. Isolation of MAGE-H1-interacting complex by immuno- precipitation. A Strategy to identify MAGE-H1-interacting partners during RA-induced neural differentiation of P19 cells. P19 cells stably expressing Flag-MAGE-H1 were maintained in ‘‘heavy’’ medium. In parallel, control cells stably expressing Flag-tag were grown in ‘‘light’’ medium. The whole cell lysates derived from each cell pool were mixed 1:1 based on the total protein mass. The MAGE-H1-interact- ing complex was purified using anti-Flag beads followed by SDS-PAGE separation, in-gel trypsin digestion, and LC–MS/MS analysis.

Figure 1B. Isolation of the MAGE-H1 complex by immunoprecipita- tion. The immunoprecipitated proteins were separated on SDS-PAGE and stained with Coomassie brilliant blue. IP immunoprecipitates. Bait protein Flag-tagged MAGE-H1 is indicated by arrow on the SDS- PAGE gel.

Figure 1C. Identification of Flag-MAGE-H1 immunoprecipitated by anti-Flag beads in pre- or mixed cell lysates(1:1) with immunoblotting. IP immunoprecipitates; IB immunoblotting.

Figure 2. SILAC analysis discriminates specific from unspecific binders. The bars represent the Log 2 base (Log2) value of fold change heavy- to-light for each identified protein. The red dotted line represents threshold (Log2 (L/H ratios) = 0.7) to distinguish the specific MAGE-H1 interactors (Log2 (L/H ratios) > 0.7). Protein rank refers to the numbers of identified proteins.

According to the stringent criteria for protein identification and quantification (see Materials and methods), a total of 95 proteins were quantified with L/H ratios (Figure 2). Us- ing significance B value (p < 0.05) as the threshold to distin- guish the specific MAGE-H1 interactors [17], 62 proteins were demonstrated as having significant abundance changes (L/H ratios >1.70 i.e. Log2 (L/H ratios) > 0.7) (Table 1). However, the known MAGE-H1 interactor, p75NTR was not identified in our experiment. We speculated that the reason for this phe- nomenon could be that our IP lysis buffer was too mild to ex- tract membrane protein p75NTR.

Subsequently, we performed functional annotation of the iden- tified proteins. The 62 proteins were assigned to 10 functional categories according to biological processes (Table 1, Figure 3), which included apoptotic process (3.1%), biological regulation (6.1%), cellular component organization or biogenesis (8.4%), cellular process (16.8%), developmental process (10.7%), im- mune system process (2.3%), localization (12.2%), metabolic process (32.8%), multicellular organismal process (4.6%) and response to stimulus (3.1%).

GO-term

(Biological Process)

Protein name ID

(UniProt)

log 2

(Ratio (H/L))

Apoptotic process
Poly(rC)-binding protein 1 P60335 1.5
Insulin-like growth factor 2 mRNA-binding protein 1 O88477 1.5
Poly(rC)-binding protein 2 Q61990 1.5
Insulin-like growth factor 2 mRNA-binding protein 3 Q9CPN8 1.2
Biological regulation
Unconventional myosin-Ib P46735 4.5
Acidic leucine-rich nuclear phosphoprotein 32 family member E P97822 2.8
Probable ATP-dependent RNA helicase DDX17 Q501J6 1.9
Eukaryotic translation initiation factor 3 subunit D O70194 1.7
Myosin-10 Q61879 1.5
Myosin-9 Q8VDD5 1.3
Eukaryotic initiation factor 4A-I P60843 1.1
N-alpha-acetyltransferase 15, NatA auxiliary subunit Q80UM3 0.8
Cellular component organization or biogenesis
Unconventional myosin-Ib P46735 4.5
40S ribosomal protein SA P14206 3
Actin, cytoplasmic 2 P63260 2.8
Actin, cytoplasmic 1 P60710 2
Myosin-10 Q61879 1.5
Tubulin beta-4B chain P68372 1.3
Src substrate cortactin Q60598 1.3
Myosin-9 Q8VDD5 1.3
Stress-70 protein, mitochondrial P38647 1.2
T-complex protein 1 subunit delta P80315 0.9
Heat shock cognate 71 kDa protein P63017 0.9
Cellular process
Unconventional myosin-Ib P46735 4.5
40S ribosomal protein SA P14206 3
Actin, cytoplasmic 2 P63260 2.8
Actin, cytoplasmic 1 P60710 2
Tubulin alpha-1A chain P68369 1.9
Poly(rC)-binding protein 1 P60335 1.5
Myosin-10 Q61879 1.5
Insulin-like growth factor 2 mRNA-binding protein 1 O88477 1.5
Tubulin alpha-1B chain P05213 1.5
Poly(rC)-binding protein 2 Q61990 1.5
40S ribosomal protein S3a P97351 1.4
Poly [ADP-ribose] polymerase 1 P11103 1.4
Tubulin beta-4B chain P68372 1.3
Src substrate cortactin Q60598 1.3
Myosin-9 Q8VDD5 1.3
Tubulin beta-5 chain P99024 1.3
Insulin-like growth factor 2 mRNA-binding protein 3 Q9CPN8 1.2
GTP-binding nuclear protein Ran P62827 1.1
DNA replication licensing factor MCM5 P49718 1
Myb-binding protein 1A Q7TPV4 1
Tight junction protein ZO-2 Q9Z0U1 0.9
40S ribosomal protein S2 P25444 0.8
Developmental process
Unconventional myosin-Ib P46735 4.5
Actin, cytoplasmic 1 P60710 2
Poly(rC)-binding protein 1 P60335 1.5
Myosin-10 Q61879 1.5
Insulin-like growth factor 2 mRNA-binding protein 1 O88477 1.5
Tubulin alpha-1B chain P05213 1.5
Poly(rC)-binding protein 2 Q61990 1.5
Tubulin beta-4B chain P68372 1.3
Src substrate cortactin Q60598 1.3
Myosin-9 Q8VDD5 1.3
Tubulin beta-5 chain P99024 1.3
Insulin-like growth factor 2 mRNA-binding protein 3 Q9CPN8 1.2
Polyadenylate-binding protein 1 P29341 1
Tight junction protein ZO-2 Q9Z0U1 0.9
Immune system process
DnaJ homolog subfamily A member 1 P63037 1.3
Heat shock cognate 71 kDa protein P63017 0.9
Heat shock protein HSP 90-beta P11499 0.8
Localization
Unconventional myosin-Ib P46735 4.5
40S ribosomal protein SA P14206 3
Actin, cytoplasmic 2 P63260 2.8
Actin, cytoplasmic 1 P60710 2
Tubulin alpha-1A chain P68369 1.9
Ras GTPase-activating protein-binding protein 1 P97855 1.8
Poly(rC)-binding protein 1 P60335 1.5
Myosin-10 Q61879 1.5
Insulin-like growth factor 2 mRNA-binding protein 1 O88477 1.5
Tubulin alpha-1B chain P05213 1.5
Poly(rC)-binding protein 2 Q61990 1.5
Tubulin beta-4B chain P68372 1.3
Myosin-9 Q8VDD5 1.3
Tubulin beta-5 chain P99024 1.3
Insulin-like growth factor 2 mRNA-binding protein 3 Q9CPN8 1.2
GTP-binding nuclear protein Ran P62827 1.1
Metabolic process
Unconventional myosin-Ib P46735 4.5
Inosine-5′-monophosphate dehydrogenase 2 P24547 3.2
40S ribosomal protein SA P14206 3
Acidic leucine-rich nuclear phosphoprotein 32 family member E P97822 2.8
Heterogeneous nuclear ribonucleoproteins C1/C2 Q9Z204 2.1
Splicing factor U2AF 35 kDa subunit Q9D883 2
Probable ATP-dependent RNA helicase DDX17 Q501J6 1.9
60S ribosomal protein L13a P19253 1.9
Lupus La protein homolog P32067 1.8
60S ribosomal protein L10 Q6ZWV3 1.7
60S ribosomal protein L4 Q9D8E6 1.7
60S ribosomal protein L8 P62918 1.7
60S ribosomal protein L10a P53026 1.7
60S ribosomal protein L19 P84099 1.7
Eukaryotic translation initiation factor 3 subunit D O70194 1.7
60S ribosomal protein L13 P47963 1.6
60S ribosomal protein L7a P12970 1.6
Poly(rC)-binding protein 1 P60335 1.5
Myosin-10 Q61879 1.5
Insulin-like growth factor 2 mRNA-binding protein 1 O88477 1.5
Poly(rC)-binding protein 2 Q61990 1.5
40S ribosomal protein S3a P97351 1.4
Poly [ADP-ribose] polymerase 1 P11103 1.4
60S acidic ribosomal protein P0 P14869 1.3
Src substrate cortactin Q60598 1.3
Aspartate–tRNA ligase, cytoplasmic Q922B2 1.3
Myosin-9 Q8VDD5 1.3
Heterogeneous nuclear ribonucleoprotein F Q9Z2X1 1.3
40S ribosomal protein S4, X isoform P62702 1.3
60S ribosomal protein L6 P47911 1.2
Stress-70 protein, mitochondrial P38647 1.2
60S ribosomal protein L7 P14148 1.2
Insulin-like growth factor 2 mRNA-binding protein 3 Q9CPN8 1.2
Eukaryotic initiation factor 4A-I P60843 1.1
GTP-binding nuclear protein Ran P62827 1.1
DNA replication licensing factor MCM5 P49718 1
Myb-binding protein 1A Q7TPV4 1
T-complex protein 1 subunit delta P80315 0.9
Heat shock cognate 71 kDa protein P63017 0.9
Heterogeneous nuclear ribonucleoprotein U Q8VEK3 0.9
Heat shock protein HSP 90-beta P11499 0.8
N-alpha-acetyltransferase 15, NatA auxiliary subunit Q80UM3 0.8
40S ribosomal protein S2 P25444 0.8
Multicellular organismal process
Poly(rC)-binding protein 1 P60335 1.5
Myosin-10 Q61879 1.5
Insulin-like growth factor 2 mRNA-binding protein 1 O88477 1.5
Poly(rC)-binding protein 2 Q61990 1.5
Myosin-9 Q8VDD5 1.3
Insulin-like growth factor 2 mRNA-binding protein 3 Q9CPN8 1.2
Response to stimulus
Poly [ADP-ribose] polymerase 1 P11103 1.4
Stress-70 protein, mitochondrial P38647 1.2
Heat shock cognate 71 kDa protein P63017 0.9
Heat shock protein HSP 90-beta P11499 0.8
Unknown
Glutathione S-transferase P 1 P19157 5.2
FGFR1 oncogene partner Q66JX5 2.8
Cell growth-regulating nucleolar protein Q08288 2.4
60S ribosomal protein L14 Q9CR57 1.7
60S ribosomal protein L18 P35980 1.6
Leucine-rich repeat-containing protein 59 Q922Q8 1.3
Aminoacyl tRNA synthase complex-interacting multifunctional

protein 2

Q8R010 1
Aminoacyl tRNA synthase complex-interacting multifunctional

protein 1

P31230 0.9
Glycine–tRNA ligase Q9CZD3 0.8

# (L/H ratios >1.70 i.e. Log2 (L/H ratios) > 0.7)

Table 1. Biological process clustering of MAGE-H1-associated proteins with SILAC ratios having significant abundance changes#

Figure 3. The 62 identified proteins were categorized according their involved biological processes using the Gene Ontology (http://www.geneontology.org). Percentages denote the proportion of identified proteins involved in each biological process.

Cite this article: Yong Liu and Shaojun Liu. High-Throughput Screening of Interaction Partners for MAGE-H1 during Retinoic Acid-Induced Neural Differentiation of P19 Cells Using SILAC-Immunoprecipitation Quantitative Proteomics Approach. J J Spine. 2017, 1(1): 002.

GO-term (Pathway) Protein name ID

(UniProt)

log 2

(Ratio (H/L))

Alzheimer disease-presenilin pathway
Actin, cytoplasmic 2 P63260 2.8
Actin, cytoplasmic 1 P60710 2
Apoptosis signaling pathway
Heat shock cognate 71 kDa protein P63017 0.9
Cadherin signaling pathway
Actin, cytoplasmic 2 P63260 2.8
Actin, cytoplasmic 1 P60710 2
Cytoskeletal regulation by Rho GTPase
Actin, cytoplasmic 2 P63260 2.8
Actin, cytoplasmic 1 P60710 2
Myosin-10 Q61879 1.5
Tubulin beta-4B chain P68372 1.3
Myosin-9 Q8VDD5 1.3
Tubulin beta-5 chain P99024 1.3
De novo purine biosynthesis
Inosine-5′-monophosphate

dehydrogenase 2

P24547 3.2
FAS signaling pathway
Poly [ADP-ribose] polymerase 1 P11103 1.4
Gonadotropin releasing hormone receptor pathway
Tubulin alpha-1A chain P68369 1.9
Tubulin alpha-1B chain P05213 1.5
Huntington disease
Actin, cytoplasmic 2 P63260 2.8
Actin, cytoplasmic 1 P60710 2
Tubulin beta-4B chain P68372 1.3
Tubulin beta-5 chain P99024 1.3
Inflammation mediated by chemokine and cytokine signaling pathway
Actin, cytoplasmic 2 P63260 2.8
Actin, cytoplasmic 1 P60710 2
Myosin-10 Q61879 1.5
Myosin-9 Q8VDD5 1.3
Integrin signalling pathway
Actin, cytoplasmic 2 P63260 2.8
Actin, cytoplasmic 1 P60710 2
Nicotinic acetylcholine receptor signaling pathway
Actin, cytoplasmic 2 P63260 2.8
Actin, cytoplasmic 1 P60710 2
Myosin-10 Q61879 1.5
Myosin-9 Q8VDD5 1.3
Parkinson disease
Stress-70 protein, mitochondrial P38647 1.2
Heat shock cognate 71 kDa protein P63017 0.9

# (L/H ratios >1.70 i.e. Log2 (L/H ratios) > 0.7)

Table 2. Pathway clustering of MAGE-H1-associated proteins with SILAC ratios having significant abundance changes#

Figure 4. The 62 identified proteins were categorized according their involved pathways using the Gene Ontology (http://www.geneontolo- gy.org). Percentages denote the proportion of identified proteins involved in each pathway.

Figure 5. Validation of interactions of MAGE-H1 with identified proteins by co-immunoprecipitation experiments. Whole cell lysates from RA-treated P19 cells were immunoprecipitated (IP) with anti-MAGE-H1 antibody. IgG antibody was used as negative control of immunopre- cipitation and 25 μg whole cell lysate was used as input. The immunoblotting (IB) were probed for the immunoprecipitated proteins with anti- GSTP1,anti- MYO1B , anti-MAGE-H1 or anti-IMDH2 antibodies respectively.

Alternatively, The 62 proteins were assigned to 12 function- al categories according to pathways (Table 2, Figure 4), which included Alzheimer disease-presenilin pathway (6.5%), apoptosis signaling pathway (3.2%), cadherin signaling path- way (6.5%), cytoskeletal regulation by Rho GTPase (19.4%), de novo purine biosynthesis (3.2%), FAS signaling pathway (3.2%), gonadotropin releasing hormone receptor pathway (6.5%), Huntington disease (12.9%), inflammation mediated by chemokine and cytokine signaling pathway (12.9%), integ- rin signaling pathway (6.5%), nicotinic acetylcholine receptor signaling pathway (12.9%) and Parkinson disease (6.5%).

To confirm the interaction between MAGE-H1 and the identi- fied proteins, we carried out immunoprecipitation of cell ex- tracts prepared from P19 cells treated with RA for 6 days to analyze the endogenous complex formation in vivo between MAGE-H1 and GSTP1, MYO1B or IMDH2. The results showed that either GSTP1, MYO1B or IMDH2 was co-precipitated with MAGE-H1 by anti-MAGE-H1 antibody in P19 cells treated with RA for 6 days (Figure 5). However, neither GSTP1, MYO1B nor IMDH2 was immunoprecipited by control IgG antibody from the same amount cell lysates (Figure 5).

In summary, this work describes the identification of interac- tors of MAGE-H1 and involvement of those interactors in the biological processes and pathways during RA-induced neural differentiation of P19 cells. Our findings may provide clues to further elucidate the functions of MAGE-H1 during neural dif- ferentiation.

Acknowledgement

This work was supported by the Chinese National Natural Sci- ence Foundation (grant numbers 81471155 and 81370051).

References
  1. Chomez P, De Backer O, Bertrand M, De Plaen E, Boon T et al. An overview of the MAGE gene family with the identification of all human members of the family. Cancer Res. 2001, 61(14): 5544-5551.
  2. Barker PA, Salehi A. The MAGE proteins: emerging roles in cell cycle progression, apoptosis, and neurogenetic disease. J Neurosci Res. 2002, 67(6): 705-712.
  3. Kuwajima T, Taniura H, Nishimura I, Yoshikawa K. Necdin in- teracts with the Msx2 homeodomain protein via MAGE-D1 to promote myogenic differentiation of C2C12 cells. J Biol Chem. 2004, 279(39): 40484-40493.
  4. Selimovic D, Sprenger A, Hannig M, Haikel Y, Hassan M. Apoptosis related protein-1 triggers melanoma cell death via interaction with the juxtamembrane region of p75 neurotro- phin receptor. J Cell Mol Med. 2011, 16(2): 349-361.
  5. Zhu F, Yan W, Zhao ZL, Chai YB, Lu F et al. Improved PCR- based subtractive hybridization strategy for cloning differen- tially expressed genes. Biotechniques. 2000, 29(2): 310-313.
  6. Hassan M, Mirmohammadsadegh A, Selimovic D, Nambiar S, Tannapfel A et al. Identification of functional genes during Fas-mediated apoptosis using a randomly fragmented cDNA library. Cell Mol Life Sci. 2005, 62(17): 2015-2026.
  7. Williamson MP, Sutcliffe MJ. Protein-protein interactions.Biochem Soc Trans. 2010, 38(4): 875-878.
  8. Bailey D, Urena L, Thorne L, Goodfellow I. Identification of protein interacting partners using tandem affinity purification. J Vis Exp. 2012.
  9. Trinkle-Mulcahy L. Resolving protein interactions and com- plexes by affinity purification followed by label-based quan- titative mass spectrometry. Proteomics. 2012, 12(10): 1623- 1638.
  10. Emmott E, Munday D, Bickerton E, Britton P, Rodgers MA et al. The cellular interactome of the coronavirus infectious bron- chitis virus nucleocapsid protein and functional implications for virus biology. J Virol. 2013, 87(17): 9486-9500.
  11. Emmott E, Goodfellow I. Identification of protein interac- tion partners in mammalian cells using SILAC-immunoprecip- itation quantitative proteomics. J Vis Exp. 2014, 89.
  12. Masse J, Piquet-Pellorce C, Viet J, Guerrier D, Pellerin I,et al. ZFPIP/Zfp462 is involved in P19 cell pluripotency and in their neuronal fate. Exp Cell Res. 2011, 317(13): 1922-1934.
  13. Keller A, Nesvizhskii AI, Kolker E, Aebersold R. Empirical statistical model to estimate the accuracy of peptide identifica- tions made by MS/MS and database search. Anal Chem. 2002, 74(20): 5383-5392.
  14. Nesvizhskii AI, Keller A, Kolker E, Aebersold R. A statistical model for identifying proteins by tandem mass spectrometry. Anal Chem. 2003, 75(17): 4646-4658.
  15. Liu Y, Yang S, Yang J, Que H, Liu S. Relative expression of type II MAGE genes during retinoic acid-induced neural differ- entiation of mouse embryonic carcinoma P19 cells: a compar- ative real-time PCR analysis. Cell Mol Neurobiol. 2012, 32(6): 1059-1068.
  16. Tcherpakov M, Bronfman FC, Conticello SG, Vaskovsky A, Levy Z et al. The p75 neurotrophin receptor interacts with multiple MAGE proteins. J Biol Chem. 2002, 277(51): 49101- 49104.
  17. Cox J, Mann M. MaxQuant enables high peptide identifi- cation rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat Biotechnol. 2008, 26(12): 1367-1372.

Be the first to comment on "High-Throughput Screening of Interaction Partners for MAGE-H1 during Retinoic Acid-Induced Neural Differentiation of P19 Cells Using SILAC-Immunoprecipitation Quantitative Proteomics Approach"

Leave a comment

Your email address will not be published.


*


Select Language