Molecular Cloning, Overexpression, Purification, Immobilization and Character- ization of Lipase from Staphylococcus pasteuri

image_print

Research Article

Molecular Cloning, Overexpression, Purification, Immobilization and Character- ization of Lipase from Staphylococcus pasteuri

Corresponding author: Dr. H Elsawy, Chemistry Department, King Faisal University, Hofuf 31982, Saudi Arabia, Email: hmostafa@kfu.edu.sa

Abstract

Thermostable lipase from Staphylococcus pasteuri was cloned, purified, immobilized and characterized. In this study, lipase gene was expressed in Escherichia coli and purified by DEAE-Sepharose and Glutathione S-sepharose 4B gel column chro- matography. Lipase enzyme was purified to homogeneity by 28 times with a final yield of 175 %. The molecular weight of the purified enzyme was estimated to be 53 kDa on SDS-PAGE. The enzyme was successfully immobilized in calcium alginate gelatin composites in the presence of glutaraldehyde. The optimal temperature and pH for the free lipase was 60oC and 8, respectively. For immobilized enzyme, the optimum activity was found to be at 65oC and pH 7.5. The free enzyme was stable for 30 min and labile at 70oC and 80oC, respectively. On the other hand, the immobilized enzyme was stable for 60 and 30 min at 70oC and 80oC, respectively. Both of the free and immobilized lipases showed elevated activities when pretreated with CaCl2, MgCl2 and BaCl2 but showed decreased activities when pretreated with CuCl2, FeCl3 and HgCl2.

Introduction

Lipases (triacylglycerol acylhydrolases, EC 3.1.1.3) are ubiq- uitous in nature and are produced by both prokaryotes and eukaryotes. Lipases of plants, animals and microorganisms correspond to the most widely present lipases but those from thermophiles have become the subject of special in- terest in biotechnological applications [1]. Bacterial lipases are of considerable commercial importance, should be ther- mostable which allow the enzymatic reaction to be carried out at higher temperatures. Although a number of lipase producing bacterial sources are available, only a few are commercially exploited as wild or recombinant strains [2]. Thermostable lipases have long been recognized to have po- tential for diverse industrial applications ranging from food and dairy, detergent, agrochemical, pharmaceutical to oleo- chemical industries. Since, periodic publications have dealt with the isolation, purification and characterization of the lipase from microorganisms [3]. Therefore, the aim of the present study was to clone, purify, immobilize and characterize both of the free and immobilized lipases. Lipase pro- tein was isolated from S. pasteuri from the eastern region in Saudi Arabia.

Materials and Methods

Microorganism and Culture Conditions: Staphylococcus pasteuri bacterial strain was isolated from Saudi Arabian environment from Audilia region that is one of the oil rich- est regions in Saudia Arabia where the temperature is above 47 oC most of the year. It was cultured in LB (Luria-Bertani) medium and the bacterial cells were grown on LB agar plates. The chromosomal DNA was isolated using the procedure described by Sambrook et al., 1989 [4].

Cloning, Overexpression and Purification of Lipase Enzyme: The lipase gene from the chromosomal DNA of Staphylococcus pasteuri was obtained by PCR using the forward primer with BamHI recognition site (5’AATA- AAGGATCCGAGGTGCTGACAATGATG3’) and the reverse primer with EcoRI recognition site (5’GTATCAGTCACGAAT- TCAGTTTTCAC3’). The PCR reaction was carried out in 20 mM Tris-HCl, pH 8.8, 10 mM (NH4)2SO4, 10 mM KCl, 0.1 % Triton

X-100, 0.1 mg/ml BSA, 2 mM MgSO4, 0.2 mM dNTPs, 50 ng/µl

each primer, 0.1 ng of DNA template and 2.5 U Pfu DNA poly-

merase in a total volume of 50 µl. PCR was performed using a program of 94oC for 4 min, 22 cycles of 94oC for 1 min, 55oC for 1 min, and 72oC for 2 min and a final incubation at 72oC for 4 min. The amplified fragment was cloned into pGEX-2T vector and the resultant plasmid pMMY004 was then used to trans- form E. coli BL21 (F- ompT hsdS (rB- mB-) gal dcm).

LB medium with ampicillin (100 µg/ml) was inoculated with 1% (v/v) of overnight culture of E. coli BL21 carrying pMMY004 and grown aerobically at 37oC until the culture reached an optical density of 0.4-0.6 at 650 nm. The culture was then in- duced by the addition of 1 mM IPTG (isopropylthio-β-D-galac- topyranoside) and grown with agitation at 200 rpm for vari- ous time (1-6 hs) at 37oC. The induced cells were harvested by centrifugation at 6000 rpm for 5 min. The cell pellet was resus- pended in buffer A (50 mM Tris-HCl pH 8.0, 50 mM NaCl, 5 mM dithiothreitol [DTT], 1.0 mM phenyl methyl sulphonyl fluoride [PMSF], 0.1 mM Benzamidine, 10 % (v/v) glycerol and Pro- teinase Inhibitor Cocktail Tablet (Boehringer Mannheim) and disrupted by sonication (five times for 30 s with 30 s interval). The purification method consisted of two steps: ion-exchange chromatography in DEAE-Sepharose fast flow column (Amer- sham Pharmacia biotech) which eluted with buffer A. The sec- ond purification step was done by affinity chromatography in DEAE-Sepharose column, eluted with buffer A supplemented with NaCl gradient (50-500 mM). Fractions with lipolytic ac- tivity were pooled and dialysed overnight in buffer B (25 mM Phosphate, 125 mM NaCl, 1 mM PMSF, 0.1 mM Benzamidine and 10 % (v/v) glycerol). The dialysed proteins were applied onto Glutathione S sepharose 4B column and eluted with 10 mM reduced glutathione in buffer B. Fractions were collected and then analyzed for purity by sodium dodecyl sulfide-poly- acrylamide gel electrophoresis (SDS-PAGE).

SDS-PAGE Electrophoresis: SDS-PAGE was carried out on 10

% running gel by using the method of Laemmli [5]. Samples were mixed with 2x reducing loading buffer and heated at 100oC for 4 min before electrophoresis. After electrophoresis, gels were stained with Coomassie brilliant blue R-250.

Lipase and Protein Assays: Lipase activity was determined by using p-nitrophenylpalmitate (p-NPP) as a substrate according to previous reports [6]. The assay mixture consisted of 0.9 ml of substrate solution, 0.1 ml sodium phosphate buffer (0.5 M) and 0.1 ml of suitable diluted enzyme. The reaction mixture was incubated for 30 min at 37 oC, pH 8, and the liberated p-ni- tophenol was measured at 410 nm in Spectronic-117 spectro- photometer. One lipase unit (U) had defined as the amount of enzyme that needed to release one µmol of p-nitrophenol per minute. Under the conditions described, the extinction coeffi-

cient of p-nitrophenol is 1.46 x 105 M-1cm-1.

The protein content was determined according to the Brad- ford (1976) [7], method using Bovine Serum Albumin (BSA) as standard.

Immobilization of lipase on calcium alginate-gelatin beads: Aqueous solutions of enzyme (1084 U/mg in 5 ml), 5

% (m/v) sodium alginate, 3% gelatin (m/v) had mixed well to form homogenous mixture. Then 0.25 % (v/v) glutaraldehyde had added and stirred on magnetic stirrer for 30 min. The mix- ture had dripped drop by drop into ice-cold calcium chloride solution. The beads had left for 30 min to harden. The super- natant was decanted, and the beads had then washed with dis- tilled water and stored at 4 oC.

Characterization of lipase enzyme

Effect of pH and temperature on lipase activity: The opti- mal pH was determined by measuring lipase activity using the standard assay conditions (40 min incubation time) but vary- ing the buffer pH from 4 to 12. The buffer utilized for pH de- pendence studies were glycine–HCl (pH 4.0–5.0), sodium hy- drogen phosphate–NaOH (pH 5.0–7.0), Tris–HCl (pH 7.0–9.0), disodium hydrogen orthophosphate-NaOH (pH 9.0–11.0), and glycine–NaOH (pH 10.0–12.0) at a concentration of 50 mM each. To analyze pH stability, the residual enzyme activity had been measured after incubating the enzyme with buffers of various pH at optimum temperature.

For the optimum temperature determination, lipase activity had been measured under standard conditions at temperature range of (20-80 oC). The immobilized enzyme had incubated at designated temperatures for different time points and the en- zymatic stability had measured and the results had compared with free enzyme using the assay described above.

Effect of metal ions on lipase activity: The effect of various metal ions (Hg2+, Cu2+, Fe2+, Ni2+, Mn2+, Mg2+, Ca2+, Cr2+, Ba2+ and Na+) on lipase activity was performed using chloride salts of the mentioned metal ions at final concentration of 1 mM. In these experiments, the enzyme had pre-incubated with metal ions for 40 min at the optimum temperature and pH and then the residual lipase activity in each case had tested on p-NPP substrate. Lipase activity without metal ions had defined as 100 %.

Results

Staphylococcus pasteuri chromosomal DNA isolation and purification: The approach of lipase cloning is on track with isolation the total chromosomal DNA from the recognized bac- terial strain S. pasteuri. Therefore, the chromosomal DNA of bacterial strain S. pasteuri was isolated and purified. To assess the superiority of the isolated DNA, the chromosomal DNA of bacterial strain S. pasteuri was digested with EcoR I or Hind III

restriction enzymes. The chromosomal DNA of bacterial strain

S. pasteuri was also used as a template to amplify the lipase gene.

The nucleotide sequence of lipase gene with the flanking re- gions, proceeding and beyond the gene in the Staphylococcus aureus (S. aureus) has been reported and the nucleotide se- quence of the lipase gene was identified as a part of the S. au- reus subsp. aureus COL genome sequence [8,9]. The sequence of lipase gene of S. aureus subsp. aureus COL contain 2046 nucleotide base pair distributed in the following number and percentage 312 G (15.25 %), 387 C (18.92 %), 505 A (24.68 %)

and 842 T (41.15 %). The lipase gene of S. aureus is AT rich.

In order to design the forward and the reverse primers that are indispensable for the lipase gene magnification, the accurate readings frame of the gene of interest should be known. There- fore, the nucleotide sequence of the above mentioned known lipase gene of S. aureus subsp. aureus COL [8] was translated into the equivalent amino acids and all the achievable six read- ing frames were recognized by the aid of ExPASy Proteomics tools (http://kr.expasy.org/). All the reading frames of the li- pase gene are represented in supplementary figures S1-6. The comparison of all the apparent reading frames and the amino acid sequence of the known lipase proteins make obvious that the accurate reading frame for the lipase gene translation is the 3’5’ frame 1.

Based on the 681 translated amino acids sequence of the data shown in the 3’5’ frame 1, primers were designed to allow the entire lipase protein to be amplified and expressed in frame with the tagged GST protein in pGEX.2T vector.

Cloning, overexpression and purification of lipase enzyme: The PCR oligonucleotide forward and reverse prim- ers were utilized to amplify the entire lipase gene of bacterial strain S. pasteuri with EcoRI and BamHI restriction sites. To decrease the mutagenic effect of the PCR process we utilized cloned Pfu DNA polymerase as a verification reading DNA poly- merase and the number of PCR cycles was minimized to 22 cy- cles to diminish the effect of polymerase-induced errors in the amplification of lipase gene. The amplified PCR product was DNA fragment of ~2.1 kb. Having confirmed the 2.1 kb purified PCR product, was the lipase S. pasteuri gene, the product was cloned in pGEX. 2T cloning vector. The recombinant plasmid DNA that contained the lipase gene was defined as pMMY004. A time course of the overproduction of GST. Lipase S. pasteuri fusion protein was studied by SDS-PAGE analysis. After addi- tion of IPTG at 1 mM final concentration at time 0 h, 1.0 ml of culture was withdrawn every hour for six hours and analysed by SDS-PAGE. The results of overproduction of the GST lipase

S. pasteuri fusion protein (~79 kDa) are shown in Figure. 1. The overproduction of GST Lipase S. pasteuri is evident after 1 hour of IPTG induction (Figure. 1, lane 2) and GST Lipase S. pasteuri fusion protein is optimally expressed after 6 hours of

IPTG induction (Figure. 1, lane 7). Having established suitable induction conditions, specifically 6 hours post-IPTG induction, a culture of E. coli lip S. pasteuri was treated in a similar way to allow purification of the GST Lipase S. pasteuri fusion protein

E. coli lip S. pasteuri cells culture were harvested and stored in 50 mM Tris. HCl (pH 8.0), 10 % (v/v) glycerol at –80 oC over- night.

Figure 1. SDS-PAGE of expressed GST-lipase protein from S. pasteuri. Lane M, protein molecular mass marker (PiereTM unstained protein MW marker (kDa); lane 1, total protein before induction with IPTG; lanes 2-7, total protein afer induction with IPTG from 1 to 6 hours, respectively.

The cells were lysed and the GST Lipase S. pasteuri fusion pro- tein purified using glutathione sepharose, after previously removing nucleic acid by applying the cell extract to a DEAE sepharose column, followed by elution with a 50-500 mM NaCl gradient. The results of the GST Lipase S. pasteuri fusion pro- tein purification scheme are shown in Figure. 2 and represent- ed in Table 1.

Steps Volume (ml) protein (mg/ml) Total activity (U) Specific activity (U/mg) Yield (%) Purification fold
Crude extract 250 16.8 2604 0.62 100 1
DEAE

Sepharose

65 13.2 1750.3 2.04 67.2 3.3
Glutathione S sepharose 4B 10 0.67 726.3 108.4 27.9 174.8

Table 1. The efficiency of purification of the GST lipase from S. pas-

teuri.

The yield of the full length GST Lipase S. pasteuri fusion pro- tein was modest as compared with the strong band in the cells lysed in loading buffer. The purification gave a 79 kDa protein

corresponding to the GST Lipase S. pasteuri fusion protein

(Figure 2, lane 3).

It is apparent that the protein content decreased progressive- ly from 16.8 mg/ml in the crude extract to 0.67 mg/ml in the eluate of the glutathione S sepharose 4B step. This is accompa- nied by a gradual increase in the specific activity of the enzyme from 0.62 U/mg proteins in the crude extract to 108.4 U/mg proteins at the final purification step, resulting in 174.8 puri- fication fold.

In view of lipase purification by many authors, the lipase was purified from B. stearothermophilus MC7 to 19.25 fold with

10.2 % yield and a specific activity of about 12 U/mg protein [10]. Hiol et al., (2000) [11] purified lipase from a thermophilic Rhizopus oryzae to 1200 fold. A thermostable lipase produced by a thermophilic Bacillus sp. J33 was purified to 175 fold by ammonium sulphate and phenyl sepharase column chroma- tography [12]. Lee et al., (1999, 2002) [13,14] purified a lipase from B. thermoleovorans IDA, and B.thermoleovorans IDB with a purification fold of 300 and 108 respectively while the over- all yield was 16 and 3.2 % respectively.

Figure 2. SDS-PAGE of purified GST-lipase from S. pasteuri. Lane M, protein molecular mass marker (PiereTM unstained protein MW marker (kDa); lane 1, crude extract; lane 2, DEAE-sepharose; lane 3, Glutathione S sepharose 4B.

Muraoka et al., (1982) [15] purified lipase of Staphylococcus

aureus 226 by ammonium sulfate precipitation followed by successive chromatographies on hydroxyapatite, Sephadex G-200 and Sephadex G-150 and this method gave 385 fold purification of the enzyme in a yield of 25 %. A thermostable alkaline lipase from Bacillus sp. RSJ.1 was purified by Shar- ma et al., (2001) [16] and got 201 fold purification and 19.7

% final yield. In addition, A lipase from C. verticillata was pu- rified to 19 purification fold using ammonium sulphate pre- cipitation, exchange chromatography and gel filtration [17]. According to Ogino et al., (2000) [18], LST.03 lipase from Pseu- domonas aeruginosa was purified to 34.7 fold with a yield of 12.6%. Pseudomonas lipase KWI.56 was purified to 13.9 fold by acetone precipitation and gel filtration by HPLC with 2.9% recovery [19]. Pseudomonas lipases obtained 31 fold with 18

% recovery [20] and 140 fold with 15 % recovery [21]. Mean- while, Pseudomonas mendocina PK.12CS lipase was purified to 240 fold with 14.8 % recovery using acetone precipitation and anion exchange chromatography [22].

SDS-PAGE analysis of lipase showed a single band with molec- ular mass estimated to be 53 kDa (Figure. 2). Smaller lipases have been reported by Lee et al., 1999 [13] (34 kDa), Paiva et al., 2000 [23] (46 kDa), Van Kampen et al., 2001[24] (45 kDa) and Abdou 2003 [25] (52 kDa). In addition, lipases from Bacil- lus sp. [26], P. aeruginosa EF2 [27], Acinetobacter calcoaceticus [28], B. subtilis 168 [29], P. pseudoalcaligenes F. 111 [20], Pseu- domonas sp. (PSL) [30], Acinetobacter calcoaceticus LP009

[31] and Burkholderia sp. Lipase [32] are reported to have low molecular weight of 22 kDa, 29 kDa, 30.5 kDa, 19 kDa, 32 kDa, 30 kDa, 23 kDa and 30 kDa, respectively.

In contrast, there are also relatively higher molecular weight lipases that have been reported from P. fluorescens MC50 [28], Bacillus strain A30.1 [33], Bacillus sp.THLO27 [34], and P. mendocina 3121.1 [35] possessing molecular weight of 55

kDa, 65 kDa, 69 kDa and 62 kDa, respectively.

Immobilization of GST.Lipase S. pasteuri fusion protein: In the present study, we reported that the GST-Lipase S. pasteu- ri fusion protein could be practically immobilized in calcium alginate gelatin composites in the presence of glutaraldehyde. The immobilized enzyme showed 74 % of the activity of the native enzyme (data not shown), indicating that the method of immobilization is predominantly suitable for lipase enzyme isolated from S. pasteuri.

Biochemical characterization of free and immobilized GST.Lipase S. pasteuri fusion protein

Effect of pH: The effect of pH on the free and immobilized GST Lipase S. pasteuri fusion protein activities were examined as represented in Figure 3. The free and immobilized lipase ac- tivities were determined over a wide pH range from 4 to 12. It appeared that the free lipase activity is low up to pH 7.5 but it increase gradually from 7.5 to 8. The most favorable pH value

for the free GST Lipase S. pasteuri fusion protein seems to be at pH 8, after which the enzyme activity declines again. How- ever, for the immobilized enzyme, the most advantageous pH appears to be 7.5. A free lipase from Pseudomonas aerugino- sa had maximum enzymatic activity at pH 8.5–9.0 [21]. Other Pseudomonas lipases, such as LST.03 [18], and F.111 [20], have their maximum activities at pH values ranging from 6.0 to 10.0. On the other hand, lipases from P. cepacia and Pseudomonas sp. KWI.56 showed optimal pH values at 5.5–6.5 [19] and 5.5– 7.0 [36], respectively. In comparison, Pseudomonas lipase PK.12CS was very stable at a broad pH range (5.6–9.0) for 14 h at 37

350

Free lipase S. pasteuri

Imm. Lipase S. pasteuri

300

250

200

150

100

50

0

20

30

40

50

60

70

80

Temperature degree (° C)

Lipase activity (U/mg protein)

°C [22]. AG.8 lipase still retained 90–100 % activity at pH 7.0–

10.0 for 24 h at 25 °C [16]. Ogino et al., (2000) [18] reported that lipase enzyme was stable at a pH range of 5.0–8.0 for 10 min at 30 °C.

160

140

Free lipase S. pasteuri

Imm. Lipase S. pasteuri

120

100

80

60

40

20

0

4

5

6

7

8 9

pH Value

10

11

12

Lipase activity (U/mg protein)

Figure 3. The effect of pH on the activity of free and immobilized GST-lipase from S. pasteuri.

Effect of temperature: The optimum temperature for the free and immobilized GST Lipase S. pasteuri fusion protein activi- ties were determined after preincubation of the enzyme for 40 minutes over a wide temperature range 20-80 ºC. The results were illustrated in Figure 4. It was apparent that the optimal temperature for the free enzyme activity is recorded at 60oC. Any further increasing in the temperature beyond the optimal leads to a significant decrease in the enzyme activity. The opti- mum temperature for the immobilized lipase is shifted to high- er temperature and recorded at 65 oC.

It is well known that increasing the temperature causes an in- crease in the inherent energy of the system and more mole- cules can obtain the necessary activation energy required for reaction to take place. The optimum temperature for the free lipase of S. pasteuri was identical to that observed for the li- pase isolated from Bacillus sp. [12], Bacillus strain A30.1 [33],

B. alcalophilus [37], P. cepacia DSM 50181 [38], B. thermoca-

tenulatus [39] and Pseudomonas sp. KWI.56 [28].

Figure 4. The effect of temperature on the activity of free and immo- bilized GST-lipase from S. pasteuri.

Many bacterial lipases have lower optimal temperature for their activity than that recorded for lipases of B. pseudomal- lei and S. pasteuri as: Acinetobacter calcoaceticus, 40°C [28], Acinetobacter calcoaceticus LP009, 50 °C [31], Acinetobacter sp. RAG.1, 55 °C [40], Alcaligenes sp. 50°C [28], B. licheniformis strain 55 °C [41], B. pumilus B26 35 °C [42], B. subtilis 168 35

°C [29], Pseudomonas sp. strain KB 700A, 35 °C [43], P. aerugi- nosa EF2 , 50 °C [27], P. aeruginosa LP 602 55 °C [34], P. fluo-

rescens AK 102 55 °C [44], P. fluorescens MC50 30–40 °C [28],

P. fluorescens NS2W 55 °C [45], P. pseudoalcaligenes F. 111 40

°C [20], Serratia marcescens 37 °C [25] and S. haemolyticus 28

°C [46]. On the other hand, higher optimum temperature were reported for lipases from other sources e.g. Burkholderia sp. 90– 100 °C [47, 32] and B. thermooleovorans ID.1 75 °C [13]. Above the optimum temperature, any further increase result- ed in a corresponding inhibition of the enzyme activity. As the temperature increases above the optimum, the energy of the system becomes sufficient to cause breakdown of hydrogen bonding and many other forces holding the tertiary structure of the protein.

Effect of incubation time: It is important to determine how the enzymatic activity changes over longer incubation time. Therefore, the free and immobilized GST Lipase S. pasteuri fu- sion protein activity was measured at different periods of incu- bation ranging from 15 to 120 min at 60 oC and 65 oC, respec- tively. The data was represented Figure. 5. It was apparent that the free and immobilized GST Lipase S. pasteuri fusion protein activity is directly proportional to time of incubation. The in- cubation period of 40 min was chosen for the free and immobi- lized GST Lipase S. pasteuri fusion protein activity throughout the present work.

free and immobilized GST lipase S. pasteuri proteins at 80 oC were studied as illustrated in Figure. 7. The free GST lipase S. pasteuri was labile protein at 80 oC. While, the immobilized GST lipase S. pasteuri protein when exposed to 80 oC the pro- tein was stable for 30 min and after that time the protein activ- ity started to decline.

Incubation time (min)

105 120

90

75

60

45

30

15

500

400

300

200

100

0

Free lipase S. pasteuri

Imm. Lipase S. pasteuri

600

200

180

160

140

120

100

80

60

40

20

0

Free lipase S. pasteuri Imm. lipase S. pasteuri

15 30 45 60 75 90 105 120 135 150 165 180

Incubation time (min)

Lipase activity (U/mg protein)

Figure 5. The effect of incubation time on the activity of free and im- mobilized GST-lipase from S. pasteuri.

Lipase activity (U/mg protein)

For other lipases this incubation time could be as short as 10 minutes and their activity is stable for that period of time e.g. Alcaligenes sp. [28], 30 minutes Bacillus sp. [26], Bacillus sp. strain 398 [48], B. thermocatenulatus [39], B. thermooleovo- rans ID.1 [13], Pseudomonas sp. [30], or as long as 1 hour Ba- cillus sp.THLO27 [49], B. alcalophilus [37] and P. fluoresces AK 102 [44].

Thermostability: The stability of free and immobilized GST lipase S. pasteuri activity at 70 oC were demonstrated as rep- resented in Figure. 6. The free GST lipase S. pasteuri protein is stable at 70 oC for 30 min and after that time, the enzyme activ- ity starts to decline gradually to 58 % after 180 min.

250

Free lipase S. pasteuri Imm. lipase S. pasteuri

200

150

100

50

0

15 30 45 60 75 90 105 120 135 150 165 180

Incubation time (min)

Lipase activity (U/mg protein)

Figure 6. The thermal stability of free and immobilized GST-lipase

from S. pasteuri at 70oC.

While, the immobilized GST lipase S. pasteuri activity at 70 oC was stable and active for 60 min and beyond that time the en- zyme activity declined. Moreover, the thermal stability of both

Figure 7. The thermal stability of free and immobilized GST-lipase

from S. pasteuri at 80 oC.

Our measured optimum temperatures were relatively high compared to 45 oC reported for lipases from Acinetobacter cal- coaceticus (40 °C) [28], Alcaligenes sp. (50 °C) [28], B. licheni-

formis strain (55 °C) [41], B. subtilis 168 (35 °C) [29], Pseu- domonas sp. strain KB 700A, (35 °C) [43], P. aeruginosa EF2 (50 °C) [27]. On studying the heat of inactivation for the free and immobilized lipase enzyme S. pasteuri at 70 and 80 oC, it was found that the enzyme activity gradually decreased after at least half an hour of incubation. This demonstrates that li- pase protein from S. pasteuri is stable at high temperature be- yond the optimal temperature for at least half an hour. Similar results were obtained for lipases from Bacillus sp. [48], B. li- cheniformis strain H1 [41], Pseudomonas sp. (PSL) [30] and B. alcalophilus [37]. Two thermostable lipases (A&B) from Bacil- lus thermooleovorans ID.1 were purified with an optimal tem- perature of 60- 65 ºC and 60 ºC for lipase A and B, respectively while their pH optima were 9 and 8.9, respectively [14]. Lipase A retained 75 % of its activity when incubated for half an hour at 60 ºC. A lipase from Bacillus sp. RSJ.1 showed optimum tem- perature and pH of 50 ºC and pH 8 and it was stable at 50 ºC for 1 hour. Lipase from B. stearothermophilus was stable up to 55

ºC for 30 min [50]. A lipase from Bacillus stearothermophilus

MC7 was purified and expressed maximum activity at 75- 80

ºC and had pH optimum within the range of 7.5. – 9.0 and was stable in alkaline pH range (7.0- 11.0) [10]. Thermal stability of lipase activity is clearly related to its configuration and sub- sequently, the melting point.

Effect of metal ions on lipase activity: It has been report- ed that, nearly one third of all known enzymes requires the presence of metal ions for their catalytic activity [51]. Metal- loenzymes contain tightly bound metal ion cofactors, most commonly transition metal ions such as Fe2+, Ni2+, Cu2+, Mn2+, and Zn2+. In addition, the presence of a mono or divalent cat- ion (or more) stimulates the enzymatic activities of many en- zymes. Cations generally form complexes with ionized fatty acids, changing their solubility and behavior at interfaces [52]. Release of fatty acids to the medium is rate determining and could be affected by the presence cations.

The effects of metal ions on lipase activity are shown in Table

2. In the present study, free and immobilized lipase activities were stimulated by several metal ions (1 mM) with highest rel- ative activity achieved when the enzyme was pretreated with BaCl2, CrCl2, CaCl2, NiCl2, MgCl2, and MnCl2 with 319 %, 261 %, 210 %, 148 %, 131 % and 113 %, respectively.

Relative Lipase activity (%)
Metals (1 mM) Free Immobilized
Control 100 100
Ba2+ 319 234
Ca2+ 210 183
Cr2+ 261 209
Cu2+ 64 11
Fe2+ 65 6
Hg2+ 89 31
Mg2+ 131 154
Mn2+ 113 168
Na+ 100 229
Ni2+ 148 116

Table 2. Effect of metal ions on GST-lipase activity. Lipase activity without addition of ions was set as 100%.

The activity of immobilized lipase was stimulated in the pres- ence of NaCl but Na+ ions have no effect on the enzymatic ac- tivity of the free lipase. The positive effect of calcium ion has been reported for lipase protein from P. aeruginosa EF2 [27], B. subtilis 168 [29], B. thermooleovorans ID.1 [13], Pseudomonas sp. [30], B. alcalophilus [37] and Acinetobacter sp. RAG.1 [40]. A probable elucidation of this observable fact is that Ca2+ has a particular enzyme activating effect that it exerts by concen- trating at the fat water interface. Therefore, calcium ions may achieve three distinct roles in lipase action: removal of fatty acids as insoluble Ca2+ salts in certain cases, direct enzyme activation resulting from concentration at the fat water inter- face, and stabilizing effect on the enzyme. In a previous study,

the activity of free lipase from B. pseudomallei was greatly en- hanced in the presence of Ba2+ [32].

However, preincubation of lipase with Cu2+, Fe2+ or Hg2+ ions inhibited the enzymatic activity. Lee et al., (1999) [13] isolated two lipases from B.thermooleovorans ID. Lipase A was inhibit- ed by divalent ions such as Cu2+, Hg2+ and Co2+. In contrast, the activity of lipase B was slightly enhanced by Ca2+, Na+, Co2+ and Mn2+ ions. Kambourova et al. (2003) [10], reported that lipase from B. stearothermophilus MC7 was inhibited by divalent ions of heavy metals, entirely by Cu2+ and strongly by Fe2+ and Zn2+ ions.

Conclusion

In conclusion, this study described the cloning and characteri- zation of a lipase from bacterial strain S. pasteuri. The expres- sion level of the recombinant enzyme in E. coli was high and allowed the production of sufficient material for successful purification in only a two purification steps with subsequent characterization. Therefore, results of the present study sug- gested the possibility of production of thermostable lipase protein from S. pasteuri using molecular biology techniques. That lipase protein was purified and effectively immobilized on the calcium alginate composite. The free and immobilized proteins were stable moderately alkaline pH and temperature around 60 oC. The supplementations of the enzyme prepara- tions with Ca2+ increase the enzyme activity. The addition of Ca2+ could significantly improve the cleansing performance towards different stains. Considering the overall properties of different alkaline enzymes of microbial origin and the thermo- stable alkaline enzymes from our strain S. pasteuri are better as regards to pH and temperature stability, efficient immobili- zation process, stability in the presence of Ca2+ for a potential application not only in heavy duty detergents for fabrics but also in bleaches and detergents for automatic dishwashing ma- chines.

References
  1. Nthangeni MB, Patterton HG, Van TA, Vergeer WP, LitthauerD. Overexpression and properties of a purified recombinant Bacillus licheniformis lipase: A comparative report on Bacillus lipases. Enzyme Microb Technol. 2001, 28(7-8): 705-712.
  2. Kanjanavas P, Khuchareontaworn S, Khawsak P, Pak- pitcharoen A, Pothivejkul K et al., Purification and Character- ization of Organic Solvent and Detergent Tolerant Lipase from Thermotolerant Bacillus sp. RN2. Int J Mol Sci. 2010, 11(10): 3783-3792.
  3. Gupta R, Gupta N, Rathi P. Bacterial lipases: an overview of production, purification and biochemical properties. Appl Mi- crobiol Biotechnol. 2004, 64(6): 763-781.
  4. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a lab- oratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, 1989.
  5. Laemmli UK. Cleavage of structural proteins during the as- sembly of the head of bacteriophage T4. Nature. 1970, 227 (5259): 680- 685.
  6. Mahadik ND, Puntambekar US, Bastawde KB, Khire JM, Gokhale DV. Production of acidic lipase by Aspergillus niger in solid state fermentation. Process Biochemistry. 2002, 38 (5): 715-721.
  7. Bradford MM. A rapid and sensitive method for the quantita- tion of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976, 72: 248-254.
  8. Gill SR, Fouts DE, Archer GL, Mongodin EF, Deboy RT et al., Insights on evolution of virulence and resistance from the complete genome analysis of an early methicillin-resistant Staphylococcus aureus strain and a biofilm-producing methi- cillin-resistant Staphylococcus epidermidis strain. J. Bacteriol. 2005, 187 (7): 2426-2438.
  9. Herron-Olson L, Fitzgerald JR, Musser JM, Kapur V. Molecu- lar correlates of host specialization in Staphylococcus aureus. PLoS ONE. 2007, 2 (10): E1120.
  10. Kambourova M, Kirilova N, Mandeva R, Derekova A. Prop- erties of thermostable lipase from a thermophilic Bacillus stearothermophilus MC7. Journal of Molecular Catalysis B. En- zymatic. 2003, 22(5-6): 307-313.
  11. Hiol A, Jonzo MD, Rugani N, Druet D, Sarda L et al., Puri- fication and characterization of an extracellular lipase from a thermophilic Rhizopus oryzae strain isolated from palm fruit. Enzyme Microb Technol. 2000, 26(5-6): 421-430.
  12. Nawani N, Singh R, Kaur J. Immobilization and stability of a lipase from thermophilic Bacillus sp.: The effect of a process parameters on immobilization of enzyme. Electro J Biotechnol. 2006, 9(5): 563-565.
  13. Lee OW, Koh YS, Kim KJ, Kim BC, Choi HJ et al. Isolation and characterization of a thermophilic lipase from Bacillus ther- moleovorans ID-1. FEMS Microbiology Letters. 1999, 179(2): 393–400.
  14. Lee DW, Kim HW, LeeKW, Kim BC, Choe EA et al. Purifica- tion and characterization of two distinct themostable lipases from the Gram positive thermophilic bacterium Bacillus ther- moleovorans ID-1. Enzyme and Microbial Technology. 2001, 29(6-7): 363-371.
  15. Muraoka T, Ando T, Okuda HJ. Purification and properties of a novel lipase from Staphylococcus aureus 226. J Biochem. 1982, 92(6): 1933-1939.
  16. Sharma AK, Tiwari RP, Hoondal GS. Properties of a thermo- stable and solvent stable extracellular lipase from a Pseudo- monas sp. AG-8, J. Basic Microbiol. 2001, 41(6): 363-366.
  17. Gopinath C, Hildal A, Priya T, Annadurai G. Purification of lipase from Cunninghamela verticillata and optimization of enzyme activity using response surface methodology. World J. Microbiol. Biotechnol. 2002, 18(5): 449-458.
  18. Ogino H, Nakagawa S, Shinya K, Muto T, Fujimura N et al. Purification and characterization of organic solvent-stable li- pase from organic solvent tolerant Pseudomonas aeruginosa LST-03, J. Biosci. Bioeng. 2000, 89(5): 451–457.
  19. Iizumi T, Nakamura K, Fukase T. Purification and character- ization of a thermostable lipase from newly isolated Pseudo- monas sp. KWI.56, Agric. Biol. Chem. 1990, 54(5): 1253-1258.
  20. Lin SF, Chiou CM, Yeh CM, Tsai YC. Purification and partial characterization of an alkaline lipase from Pseudomonas pseu- doalcaligenes F-111, Appl. Environ. Microbiol. 1996, 62(3): 1093-1095.
  21. Gilbert EJ, Cornish A, Jones CW. Purification and properties of extracellular lipase from Pseudomonas aeruginosa EF2, J. Gen. Microbiol. 1991, 137(9): 2223–2229.
  22. Jinwal UK, Roy U, Chowdhury AR, Bhaduri AP, Roy PK. Puri- fication and characterization of an alkaline lipase from a newly isolated Pseudomonas mendocina PK-12CS and chemoselec- tive hydrolysis of fatty acid ester, Bioorg. Med. Chem. 2003, 11(6): 1041–1046.
  23. Paiva AL, Balcão VM, Malacta FX. kinetics and mechanisms of reactions catalyzed by immobilized lipases. Enzyme Micro- biol Technol. 2000, 27(5-6): 187–204.
  24. Van Kampen MD, Rosenstein R, Götz F, Egmond MR. Cloning, purification and characterization of Staphylococcus warneri li- pase 2. Biochim Biophys Acta. 2001, 1544(1-2): 229–241.
  25. Abdou AM. Purification and partial characterization of psychrotrophic Serratia marcescens lipase. J Dairy Sci. 2003, 86(1): 127-132.
  26. Sugihara A, Tani T, Tominaga Y. Purification and character- ization of a novel thermostable lipase from Bacillus sp. J Bio- chem. 1991, 109(2): 211-216.
  27. Gilbert EJ. Drodzd JW, Jones CW. Physiological regulation and optimization of lipase activity in Pseudomonas aeruginosa EF2. J. Gen. Microbiol. 1991, 137(9): 2215-2221.
  28. Brune AK, Gotz F. Degradation of lipids by bacterial lipases. In: Winkelman G (edn) Microbial degradation of natural prod- ucts. VCH, Weinhein. 1992, 243-266.
  29. Lesuisse E, Schanck K, Colson C. Purification and prelim- inary characterization of the extracellular lipase of Bacillus subtilis 168, an extremely basic pH-tolerant enzyme. Eur J Bio- chem. 1993, 216(1): 155-160.
  30. Dong H, Gao S, Han S, Cao S. Purification and character- ization of a Pseudomonas sp. lipase and its properties in non-aqueous media. Biotechnol Appl Biochem. 1999, 30(Pt 3): 251-256.
  31. Pratuamgdejkul J, Dharmsthiti S. Purification and charac- terization of lipase form psychrophilic Acinetobacter calcoace- ticus LP009. Microbiol Res. 2000, 155(2): 95-100.
  32. Bradoo S, Rathi P, Saxena RK, Gupta R. Microwave assisted rapid characterization of lipase selectivities. J Biochem Bio- phys Methods. 2002, 51(2): 115-120.
  33. Wang Y, Srivastava KC, Shen GJ, Wang HY. Thermostable alkaline lipase from a newly isolated thermophilic Bacillus, strain A30-1 (ATCC 53841). J Ferment Bioeng. 1995, 79(5): 433-438.
  34. Dharmsthiti S, Kuhasuntisuk B. Lipase from Pseudomonas aeruginosa LP602: biochemical properties and application for wastewater treatment. J Ind Microbiol Biotechnol. 1998, 21(1): 75-80.
  35. Surinenaite B, Bendikiene V, Juodka B, Bachmatova I, Mar- cinkevichiene L. Characterization and physicochemical prop- erties of a lipase from Pseudomonas mendocina 3121-1. Bio- technol Appl Biochem. 2002, 36(Pt 1): 47-55.
  36. Sugihara A, Ueshima M, Shimada Y, Tsunasawa S, Tomina- ga Y. Purification and characterization of a novel thermostable lipase from Pseudomonas cepacia. J. Biochem. 1992, 112(5): 598-603.
  37. Ghanem EH, Al Sayeed HA, Saleh, KM. An alkalophilic ther- mostable lipase produced by a new isolate of Bacillus alcaloph- ilus. World J Microbiol Biotechnol. 2000, 16(5): 459-464.
  38. Dunhaupt A, Lang S, Wagner F. Properties and partial pu- rification of a Pseudomonas cepacia lipase. In: Alberghina L, Schmid RD, Verger R (eds) Lipases: structure, mechanism and genetic engineering. VCH, Weinheim. 1991, 389-392.
  39. Schmidt Dannert C, Rúa ML, Atomi H, Schmid RD. Ther- moalkalophilic lipase of Bacillus thermocatenulatus. I. Molec- ular cloning, nucleotide sequence, purification and some prop- erties. Biochim Biophys Acta. 1996, 1301(1-2): 105-114.
  40. Snellman EA, Sullivan ER, Colwell RR. Purification and properties of the extracellular lipase, Lip A, of Acinetobacter sp. RAG-1. Eur J Biochem. 2002, 269(23): 5771-5779.
  41. Khyami-Horani H. Thermotolerant strain of Bacillus li- cheniformis producing lipase. World J Microbiol Biotechnol. 1996, 12(4): 399-401.
  42. Kim HK, Choi HJ, Kim MH, Sohn CB, Oh TK. Expression and characterization of Ca2+.independent lipase from Bacillus pumilus B26. Biochim Biophys Acta. 2002, 1583(2): 205-212.
  43. Rashid N, Shimada Y, Ezaki S, Atomi H, Imanaka T. Low tem- perature lipase from psychrotrophic Pseudomonas sp. Strain KB700A. Appl Environ Microbiol. 2001, 67(9): 4064-4069.
  44. Kojima Y, Yokoe M, Mase T. Purification and characteriza- tion of an alkaline lipase from Pseudomonas fluorescens AK102. Biosci Biotechnol Biochem. 1994, 58(9): 1564-1568.
  45. Kulkarni N, Gadre RV. Production and properties of an al- kaline, thermophilic lipase from Pseudomonas fluorescens NS2W. J Ind Food Microbiol. 2002, 28(6): 344-348.
  46. Oh BC, Kim HK, Lee JK, Kang SC, Oh TK. Staphylococcus hae- molyticus lipase: biochemical properties, substrate specificity and gene cloning. FEMS Microbiol Lett. 1999, 179(2): 385-392.
  47. Rathi P, Bradoo S, Saxena RK, Gupta R. A hyperthermo- stable, alkaline lipase from Pseudomonas sp. with the property of thermal activation. Biotechnol Lett. 2000, 22(6): 495-498.
  48. Kim EK, Sung MH, Kim HM, Oh TK. Occurrence of thermo- stable lipase in thermophilic Bacillus sp. strain 398. Biosci Bio- technol Biochem. 1994, 58(5): 961-962.
  49. Dharmusthii S, Luchai S. Production, purification and char- acterization of thermophilic lipase from Bacillus spTHL0127. FEMS Microbiol. Lett. 1999, 179: 241-246.
  50. Kim MH, Kim HK, Lee JK, Park SY, Oh TK. Thermostable lipase of Bacillus stearothermophilus: highlevel production, purification, and calcium-dependent thermostability. Biosci Biotechnol Biochem. 2000, 64(2): 280-286.
  51. Voet D, Voet JG, Pratt CW. Fundamentals of Biochemistry, John Wiley, New York. 1960.
  52. Fameau AL, Arnould A, Jalmes AS. Responsive self-assem blies based on fatty acids. Curr Opin Colloid Interface Sci. 2014, 19(5): 471-479.

Be the first to comment on "Molecular Cloning, Overexpression, Purification, Immobilization and Character- ization of Lipase from Staphylococcus pasteuri"

Leave a comment

Your email address will not be published.


*